1.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
2.
Exploration Of Genetic Polymorphisms And Differential Expression Analysis Of Bovine Alpha-Lactalbumin And Osteopontin Genes Involved In Milk Composition
by Sidra Manzoor (2010-VA-92) | Dr. Asif Nadeem | Muhammad Imran | Dr. Abu Saeed Hashmi.
Material type: Publisher: 2017Dissertation note: Economically important traits of dairy animals are usually controlled by a large number of genes. The identification of the single nucleotide polymorphisms in potential genes has been associated with economically important traits. During lactation, mammary epithelial cells produced large amounts of specific milk proteins. Due to the expression sites, physiological properties and chromosomal localization, LALBA and SPP1 genes might be considered as candidate genes for milk composition in buffalo. Alpha-lactalbumin (LALBA) gene has been reported to be highly transcribed in transition and peak phase while late lactation exhibited its decline with progressive rise in SPP1 expression. This project was designed to investigate the effect of single nucleotide polymorphism that influencing the gene expression thus modulates the milk protein content in Nili Ravi. Samples of unrelated Nili-Ravi buffalo were collected from two Government, Buffalo Research Institute, Pattoki, and Livestock Production and Research Institute (LPRI) Bahadarnagar Okara, livestock farms. Milk samples were collected at 15, 90 and 250 days lactation for expression analysis. The genomic DNA was extracted by using the standard Phenol Chloroform Isoamyl alcohol (PCI) protocol. Specific set of primers was designed for the amplification of the LALBA and SPP1 genes. The amplified PCR products were sequenced for the identification of SNPs. To determine the differential expression of bovine LALBA and SPP1 genes, RNA was isolated from milk samples using the TRIzol reagent and converted it into cDNA. Taqman probes were used that are specifically designed to detect and target the DNA sequence. Five intronic polym orphic sites were identified in LALBA while exonic regions exhibited a complete homology with reference sequence. Additionally, eleven polymorphisms were identified in bovine SPP1 gene, six were in coding region and five were
Summary
122
found in intronic portion of the gene. The analysis and correlation of all identified polymorphism was done by using SNPs data analysis software “SNPator”. Results obtained from expression study was stored in in-build software of Real Time PCR and Cycle threshold (Ct) values of LALBA and SPP1 mRNA were compared in individuals of Nili-Ravi buffalo to determine the variation in expression levels. The LALBA gene expression was observed highest in transition phase with a gradual decrease of expression in mid and late lactation. The sample, NR-5, was observed highly expressed (79.30) while NR-2 with low expression (19.28) for alpha lactalbumin in early lactation. The change in LALBA regulation at same stage was considered due to genetic variation of the respective animal. While the SPP1 gene expression was observed with the highest values in peak lactation and remains elevated in late lactation. NR-4 has the highest (72.27) expression among all mastitis free healthy animals while NR-2 was observed with low expression. Thus, the identified SNPs might be used as genetic marker for milk production traits. Gene expression patterns may also help us to understand the molecular mechanisms of bovine LALBA and SPP1 genes influencing milk composition. However, the expression of both genes was considered in a correlation with other genes involved in milk production pathway. Also, the mutational effects of other milk proteins might be involved in determining the expression pattern of both genes in selected animals. Therefore, further studies are likely to explore the regulation of milk protein genes and their translational efficiency during the course of lactation in dairy animals. Availability: Items available for loan: UVAS Library [Call number: 2830-T] (1).
3.
Evaluation Of Different Strategies To Improve The Dietary Nitrogen Efficiency In Lactating Dairy Cows In Pakistan
by Muhammad Imran (2005-VA-09) | Prof. Dr. Talat Naseer Pasha | Dr. Muhammad Naveed ul Haque | Dr. Muhammad Qamer Shahid.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The objectives of this study were to optimize the protein supplies and replacement of SBM with locally available ingredients in the rations of high producing Holstein Friesian cows at mid lactation. On the basis of these objectives, three experiments were conducted. Multiparous cows in mid-lactation received three treatments in a 3×3 Latin square design with a period length of 20 d. Number of animals used were nine in 1st and 3rd experiments and 12 in 2nd experiment (Table 6.1). The trials were conducted at a corporate dairy farm. When we compare the initial and final values of milk yield, milk fat and milk protein contents, there is not a big difference of our diets with that currently being practiced in Pakistan (Table 6.1). This also reveals that the experimental milk production was close to pre-experimental milk production indicating that a successful dietary transition was achieved. Table 6.1: Demonstration of parameters before and during the experiments Exp.
Cows
No.
Initial Parameters During Experiment Parameters
DIM Milk
yield (kg)
Milk
fat (%)
Milk
protein (%)
Milk
yield (kg)
Milk fat
(%)
Milk
protein (%)
1 9 113±25 32±4.1 3.65 3.25 29.7±3.1 3.70 3.27
2 12 153±44 23.3±2.1 3.99 3.34 24.7±1.8 3.98 3.31
3 9 109±19 34±3.7 3.71 3.19 30.7±2.5 3.64 3.21
Exp., experiment; DIM, days in milk In the 1st experiment, three dietary treatments were designed to provide similar energy and increasing supply of MP (g/d)—2371 (low), 2561 (medium), and 2711 (high). Increasing the MP supplies did not modify DMI; however, it increased milk protein, fat, and lactose yield linearly. Similarly, FCM increased (9.3%) linearly due to an increase in both milk yield (5.2%) and milk fat content (7.8%). Milk nitrogen efficiency decreased from 0.26 to 0.20, whereas, the
Summary
102
metabolic efficiency of MP decreased from 0.70 to 0.60 at low to high MP supplies and it average value across the treatments was 0.64 (Table 6.2). In conclusion, increasing the MP supplies resulted in increased milk protein yield; however, a higher BUN and low MNE indicated an efficient utilization of dietary protein in low MP supplies. Milk nitrogen efficiency ranges from 20 to 30% in dairy cows at mid stage of lactation. Milk nitrogen efficiency increases slightly but linearly with the increase of dietary protein up to a certain level of supply of protein. At high protein levels of dietary protein MNE is low and vice versa. In the 2nd experiment, the response of balancing metabolizable Lys to Met ratio (3:1) in low protein diets was investigated. Three experimental diets; 1) LP−: low protein diet (13.6% CP) with imbalanced Lys to Met ratio (3.33), 2) LP+: low protein diet (13.5% CP) with balanced Lys to Met ratio (2.94) through HMBi; and 3) HP−: high protein diet (14.7% CP) without balancing Lys to Met ratio (3.39) in a 3×3 Latin square design were designed. Milk yield of LP- was 0.85 kg/d less as compared with the average milk yield of LP+ and HP-. Dry matter intake decreased by 0.7 kg/d in LP+ compared to HP- treatment whereas milk yield tended to be higher by 0.7 kg/d and protein yield by 23 g/d. Balancing the Lys to Met ratio by supplementing HMBi through feed increased feed, N, and MP conversion efficiencies to milk by 4.4, 1.6, and 13.1% respectively compared to the HP- diet. Similarly, 4% FCM was increased by 4.4% in LP+ diet as compared to HP- diet. Moreover, plasma urea concentration was numerically less in LP+ compared to LP- and HP- treatments whereas no effect was observed on plasma glucose and TG concentrations. In the 3rd experiment, three diets 1) Control: with low protein with SMB as a protein source, 2) SBMD: high protein diet with SBM as a major protein source and 3) CGMD: high
Summary
103
protein diet with CGM as a major protein source. Increasing the protein supplies did not affect DMI, milk fat yield, and milk fat and lactose contents in SBMD and CGMD diets compared to the control diet. Similarly, MP balance and MP/NEL increased by 31.5 and 9.1%, respectively. Increasing the protein supplies tended to increase milk yield. Similarly, milk protein and lactose yield increased by 3.5 and 3.3%, respectively. Milk protein contents tended to increase by 1.5% in SBMD and CGMD treatments compared to the control. Increasing the dietary protein supplies increased FE in SBMD and CGMD treatments compared to control, whereas, MNE decreased by 10.9%. No effect was observed on DM, N and NEL intakes when SBM was partially replaced with CGM. Consequently, milk yield, milk components’ yield, milk composition and feed efficiency remained unaffected. Contrary to this, MNE decreased by 5% in CGM treatment compared to SBM. There were no dietary treatment effects on blood metabolites including BUN, glucose and TG concentrations, which means neither replacement of SBM nor concentration of protein in the diet affected the blood metabolites profile. There was no change in lactation performance of cows by the partial replacement of SBM with CGM. Therefore, SMB could be partially replaced with CGM with urea without affecting animal performance, and saving the feed cost. Table 6.2: Effects of experimental diets on different parameters Exp.
MP
efficiencies
Δ MP
efficiencies (%)
Δ MY
(kg)
Δ DMI
(kg)
Δ milk
fat (%)
Δ milk
protein (%)
1 0.64 14.3 5.20 0.10 7.80 5.30
2 0.65 11.6 1.20 0.70 3.93 1.50
3 0.68 9.85 1.10 0.20 2.18 1.10
Exp., experiment; MP, metabolizable protein; MY, milk yield; DMI, dry matter intake
Summary
104
In conclusion, balancing Lys to Met ratio at low protein diets and partial replacement of SMB with CGM is a mean to improve the MNE and reduce feed costs. 6.1 Conclusion and Recommendations Diets with low MP supply result in high MNE and better utilization with low levels of BUN. Although there was less milk yield in low protein diets but utilizing efficiency was high. Low protein corn-soy-based diets supplemented with rumen protected Met (HMBi) result in increased utilization of protein and low levels of BUN. Partial replacement of SBM with CGM plus urea showed no change in DMI, milk yield. Milk nitrogen efficiency was slightly decreased in CGM diet as compared to SBM diet. Feed cost could be saved by replacing 35% SBM with CGM provided that RDP is balanced by using NPN sources. Diets should be given with possible lowest protein levels having balanced AA particularly Lys and Met, which should be 3:1. High levels of protein could result into increased emission of gases to the environment. Soybean meal replacement with CGM along with some NPN source results in similar outcomes. First strategy is the best out of three currently tested and it can save money. 6.2 Future Perspectives Studies must be conducted to investigate the effects of further lowering the dietary protein levels without affecting milk production in Holstein cows. It will help to improve the dietary N utilization for milk synthesis. The above-mentioned strategies can also be tried simultaneously for improved protein/N utilization in dairy cows. Lysine can also be tried along with Met to balance the low protein corn-soy-based diets. On the basis of RDP and RUP values, other ingredients can also be tried to partially replace SMB. Availability: Items available for loan: UVAS Library [Call number: 2920-T] (1).
4.
Bacterial Profiling And Development Of Molecular Diagnostic Assays For Detection Of Bacterial Pathogens Associated With Bovine Mastitis
by Aqeela Ashraf (2012-VA-388) | Dr. Muhammad Imran | Prof. Dr. Tahir Yaqub | Dr. Muhammad Tayyab.
Material type: ; Literary form:
not fiction
Publisher: 2017Dissertation note: The livestock sector plays a critical role in strengthening the economy of Pakistan. Control of livestock diseases is the primary objective of government livestock departments. Bovine mastitis is among the most significant diseases of livestock as reported by various field surveys in Pakistan. Despite considerable knowledge about mastitis and its etiology, this disease is still prevalent in many dairy herds; it remains most difficult to eradicate or control. It is an inflammation of mammary gland resulting in decreased milk production, veterinary care costs and culling losses.
In animal health improvement, there is a paradigm shift from treatment of clinical illness to disease prevention. Recognition of disease is the foundation of disease control and prevention. California mastitis test and somatic cell counting are the most commonly used methods for diagnosis of bovine mastitis. These methods are unable to identify the causative agent. Detection of pathogen is critically important for better control of mastitis. Microbial culturing and biochemical tests are traditionally used methods for pathogen identification. But, these methods are very time consuming and can only detect viable bacteria from the sample and can lead to false negative results. The progress in molecular methods based on PCR has improved the veterinary diagnostics.
For the identification of bovine mastitis pathogens, an economical, rapid and sensitive molecular diagnostic assay was developed using multiplex PCR, detecting the pathogenic species-specific DNA. The target species areS. aureus,E. coli, S. uberis, S. agalactiae, S. dysagalactia, S. haemolyticus, S. epidermidis, S. chromogenes andM. bovis. Multiplex PCR assay was developed for the detection of these significantly important bacterial pathogen
causing bovine mastitis. Species specific primers were designed which have the ability to specifically amplify the particular gene in the target species. For this purpose various gene regions were selected for different bacterial species which included 16S rRNA, cpn60, phoA and rdr. Initially monoplex PCRs were optimized individually for each target species. For optimizing multiplex PCR assay, various combinations of individual PCRs with varying concentrations of primers and template DNA were used. The final protocol included all the nine sets of primer pairs, every set targeting a unique mastitic pathogen. Multiplex PCR assay was checked for its specificity and analytic sensitivity was calculated. Mastitic milk samples were collected aseptically from various farms. Initial screening was based on Surf field mastitis test and California mastitis test. Milk samples were cultured on nutrient agar, blood sheep agar and MacConkey’s agar. The bacterial isolates were identified and further sub-cultured in nutrient broth. All the isolates were identified on the basis of 16S rRNA sequencing analysis.
The developed multiplex PCR assay was used to detect the target bacterial pathogens from the collected milk samples. Limit of detection of developed assay was up to 50 pg for DNA isolated from pure cultures and 104 CFU/ml for spiked milk samples. The results obtained by 16S rRNA sequencing, bacterial culture based identification and multiplex PCR assay were compared. Sensitivity and specificity were calculated using latent class analysis, specificity was up to 88% and sensitivity was up to 98% for targeted mastitic pathogens. The developed multiplex PCR detected nine bacterial species in a single reaction. Multiplex PCR assay has also detected the bacterial pathogens in a few culture-negative mastitis milk samples. This is the first multiplex PCR assay which can efficiently detect nine important mastitic bacterial pathogens in a single reaction. The development of multiplex PCR assay is useful in early diagnosis and prevention & control of bovine mastitis.
Mycoplasma is often ignored as a major mastitis-causing pathogen due to lack of rapid and accurate diagnostic tools. In this study a LAMP assay was developed for the identification of M. bovis from clinical mastitic milk samples. LAMP primers were designed from three gene regions including uvrC, 16S rRNA and gyrB. Bacterial reference strains and mastitic milk samples positive for M. bovis were collected from Quality Milk Production Services, Cornell University, Ithaca, NY. Bacterial strains were further cultured on Hayflick medium containing 15% horse serum and incubated for up to 7 d at 37°C with CO2 enrichment. DNA was isolated from mastitic milk samples and bacterial culture using Qiagen DNeasy Blood and Tissue Kit (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions with few modifications. PCR and LAMP assay was performed for all the samples obtained. Analytic sensitivity was calculated and the limit of detection was up to 50pg/reaction for LAMP assay which is higher as compared to PCR.
Sensitivity and specificity was calculated for each of the three tests. Cohen’s kappa values obtained were 0.940 for uvrC, 0.970 for gyrB and 0.807 for 16S rRNA. All three tests showed a high level of agreement between test results and the true mastitis status, indicated by the receiver operating characteristic (ROC) curve. A robust, sensitive and specific LAMP assay has been developed for the detection of M. bovis from mastitic milk. These novel molecular assays could be helpful for correct and timely identification of bovine mastitic pathogens, which is crucial for the control and treatment of the disease.Molecular diagnostic assayshave been developed in the current study based on multiplex PCR assay and loop-mediated isothermal amplification assay.
Availability: Items available for loan: UVAS Library [Call number: 2930-T] (1).
